MICRO RNA 297; MIR297

Alternative titles; symbols

• miRNA297

HGNC Approved Gene Symbol: MIR297

Cytogenetic location: 4q25 Genomic coordinates (GRCh38): 4:110,860,581-110,860,646 (from NCBI)

▼ Description
MicroRNAs (miRNAs), like MIR297, are 21- to 23-nucleotide single-stranded noncoding RNAs that posttranscriptionally regulate gene expression by binding to complementary sequences in the 3-prime UTRs of target mRNAs, usually resulting in gene silencing (Xu et al., 2012).

▼ Gene Function
Using microarray analysis and quantitative RT-PCR, Xu et al. (2012) found that expression of MIR297 was downregulated in chemotherapy-resistant human colorectal carcinoma cell lines compared with their parental cell lines. Downregulation of MIR297 was inversely proportional to expression of a putative target, multidrug resistance-associated protein-2 (MRP2, or ABCC2; 601107). Quantitative RT-PCR and Western blot analyses revealed that expression of MIR297 and MRP2 progressively decreased and increased, respectively, with clinical stage in human colorectal carcinomas. Reporter gene assays confirmed that MRP2 was a direct target of MIR297. Expression of an MIR297 mimic increased cell sensitivity to anticancer drugs and induced apoptosis in colorectal cancer cells in vitro and in vivo following injection into nude mice.

Wang et al. (2012) found that high serum MIR297 concentration correlated with death from sepsis.

▼ Mapping
Hartz (2013) mapped the MIR297 gene to chromosome 4q25 based on an alignment of mature MIR297 sequence (AUGUAUGUGUGCAUGUGCAUG) with the genomic sequence (GRCh37).