MICRO RNA 367; MIR367

Alternative titles; symbols

• miRNA367

HGNC Approved Gene Symbol: MIR367

Cytogenetic location: 4q25 Genomic coordinates (GRCh38): 4:112,647,873-112,647,940 (from NCBI)

▼ Description
MicroRNAs (miRNAs), such as MIR367, are short noncoding RNAs that provide a novel layer of gene regulation by targeting specific mRNAs for degradation or translational inhibition (Scheel et al., 2009).

▼ Cloning and Expression
Scheel et al. (2009) reported the mature sequence of MIR367 as AAUUGCACUUUAGCAAUGGUGA.

▼ Mapping
Scheel et al. (2009) indicated that MIR367 is genetically linked with the MIR302 gene cluster (see MIR302A; 614596). Gross (2012) mapped the MIR367 gene to chromosome 4q25 based on an alignment of the MIR367 mature sequence (AAUUGCACUUUAGCAAUGGUGA) with the genomic sequence (GRCh37).